![](https://parts.igem.org/images/partbypart/icon_other.png)
Part:BBa_K4971005
Because of the potential danger of damaging the plasmid, Cas/CRISPR system in the target E.coli ought to be silenced. Specifically, in our project, we have added a detrimental plasmid to the bacteria, a gene of lactoferrin isoform 4(LTF), which has strong bactericidal ability. We find that our plamid may be damaged during the expression of LTF, evidenced by the shorter product than expection. We doubt that the CRISPR system of the target cell cut the plasmid, so we try to design a tool to silence it. The well-adapted spCas9/CRISPR is chosen, which protospacer adjacent motif(PAM) is NGG and the gRNA sequence is chosen based on this. It's well-known that gRNA should have lenth around 20 bp, alongside with C-G start and end to aquire high binding energy. The RNA sequence is retrotranscripted to DNA sequence for better apply in plasmid.
CAAAAAAGCGAAACGCGCCC”TGG” is the 178-156 bases in Cas6 CDS, and the PAM sequence is noted, CAAAAGCCGCGCGTTCGGCTG”TGG” is the 594-617 bases in Cas6 CDS, and the PAM sequence is noted.
None |